hutI

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

hutI
168

imidazolone-5-propionate hydrolase

locus
BSU_39370
Molecular weight
45.40 kDa
pI
5.22
Protein length
Gene length
function
histidine utilization
product
imidazolone-5-propionate hydrolase
essential
no
ec
3.5.2.7
synonyms
hutI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1228

This gene is a member of the following regulons

Gene
Coordinates
4,045,245 → 4,046,510
The protein
Catalyzed reaction/ biological activity
4-imidazolone-5-propanoate + H2O --> N-formimidoyl-L-glutamate (according to UniProt)
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
Structure
[PDB|2BB0] [Pubmed|16990261]
[AF|P42084]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
description
[Pubmed|10746760]
regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]→[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]

2022-04-28 01:45:51

ghost

20

cf3eb91928f3fe61cbc0cd204535c4f9c144314a

0AE45FCE38B0E774CFFC5F6A0A98EEDF6B02F4D4

Biological materials
Mutant
BKE39370 (Δ[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCTTTGGCATGTCATCAC,  downstream forward: _UP4_GTTGTCAACAGGGAGGGAGC
BKK39370 (Δ[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCTTTGGCATGTCATCAC,  downstream forward: _UP4_GTTGTCAACAGGGAGGGAGC
References
Reviews
22933560
Original Publications
10746760,8071225,8682780,10217782,16990261,27711543,18442260

BD3382760B704972A0E67ECEDA4B29AA4ECD8164

Page visits: 1941

Time of last update: 2022-05-18 21:11:07

Author of last update: Melvin.boenninger