ydhE

ydhE
168

similar to macrolide glycosyltransferase

locus
BSU_05720
Molecular weight
42.87 kDa
pI
5.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydhE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1819

This gene is a member of the following regulons

Gene
Coordinates
618,095 → 619,282
The protein
Protein family
UDP-glycosyltransferase family (with [protein|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC] and [protein|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK], according to UniProt)
Structure
[PDB|2IYA] (from Streptomyces antibioticus, 28% identity) [pubmed|17376874]
[AF|O05496]
Expression and Regulation
Operons
genes
[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]
description
[Pubmed|20639339]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, weak, in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
Open in new tab

[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]

2022-11-25 00:21:50

ghost

11

dba885309fcc76b84983e674ae831c9d1b7c4293

C5B2E2E8E519DE79CCAB0B9B43AFC530B6481B2F

Biological materials
Mutant
MGNA-C180 (ydhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2178 NBRP B. subtilis, Japan]
BKE05720 (Δ[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAGACAACTCCCTCTC,  downstream forward: _UP4_TAAGAAAAAGAACTCCCGTA
BKK05720 (Δ[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAGACAACTCCCTCTC,  downstream forward: _UP4_TAAGAAAAAGAACTCCCGTA
References
20639339,27130432,17376874,31786106

BD82663B1BF2763D2D2DE710C2896E4155419324

Page visits: 2348

Time of last update: 2022-11-29 07:17:48

Author of last update: Jstuelk