

undecaprenyl (UnDP) priming UDP-N-acetyl-glucosamine transferase, synthesis of extracellular poly-N-acetylglucosamine

Molecular weight
39.65 kDa
Protein length
Gene length
synthesis of extracellular poly-N-acetylglucosamine
undecaprenyl (UnDP) priming UDP-N-acetyl-glucosamine transferase
epsH, yveR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0463

This gene is a member of the following regulons

3,521,111 → 3,522,145
Phenotypes of a mutant
altered cell death pattern in colonies [Pubmed|23012477]
The EAR [wiki|RNA switch]
The protein
Catalyzed reaction/ biological activity
production of UnDP-3-O-acyl N- acetylglucosamine [Pubmed|26078454]
Protein family
[wiki|glycosyltransferase 2 family] (according to UniProt)
Paralogous protein(s)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2022-11-22 16:41:05





Biological materials
MGNA-A067 (yveR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/67 NBRP B. subtilis, Japan]
BKE34300 (Δ[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGACCGGCTCCTCGT,  downstream forward: _UP4_AAAATGAGAAACAGAGGGTG
BKK34300 (Δ[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGACCGGCTCCTCGT,  downstream forward: _UP4_AAAATGAGAAACAGAGGGTG
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]


Page visits: 3072

Time of last update: 2022-11-25 17:39:07

Author of last update: Melvin.boenninger