pbpG

pbpG
168

class A penicillin-binding protein 2d

locus
BSU_37510
Molecular weight
71.66 kDa
pI
9.39
Protein length
Gene length
function
bifunctional glucosyltransferase/ transpeptidase, synthesis of spore peptidoglycan
product
penicillin-binding protein 2d
essential
no
synonyms
pbpG, ywhE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0744

This gene is a member of the following regulons

Gene
Coordinates
3,849,818 → 3,851,893
Phenotypes of a mutant
a strain lacking all four class A [wiki|penicillin-binding proteins] ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] [gene|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD] [gene|73275060537497E6A9859856C9F040763E36316B|pbpF] [gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]) is severely inhibited for L-form switching in the presence of D-cycloserine [pubmed|29456081]
The protein
Catalyzed reaction/ biological activity
synthesis of spore peptidoglycan (with [protein|73275060537497E6A9859856C9F040763E36316B|pbpF]) [pubmed|11567005]
[GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H+ (according to UniProt)
Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
Protein family
N-terminal part: [wiki|glycosyltransferase 51 family] (according to UniProt)
C-terminal part: [wiki|transpeptidase family] (according to UniProt)
Structure
[PDB|3VMA] (PBP1B from E. coli, 29% identity) [pubmed|19458048]
[AF|P70997]
Paralogous protein(s)
[protein|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD], [protein|73275060537497E6A9859856C9F040763E36316B|pbpF], [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]
[wiki|Localization]
cell membrane, the major part of the protein is exposed to the outside (according to UniProt)
prespore [http://www.ncbi.nlm.nih.gov/sites/entrez/15758244 Link to a summary]
Expression and Regulation
Operons
genes
[gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|16497325,15758244,10767540]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,15758244,10767540], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|pbpG]' and '[protein|search|ywhD]' [PubMed|20525796]
Open in new tab

[gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]

2023-02-04 20:49:42

ghost

25

0079bb30b46740bbe9c1d9c0bcee5ecef16f499e

9C3D2E42E4E39A8C15BD65AB3FB14ACA3A170EA1

Biological materials
Mutant
MGNA-A520 (ywhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/520 NBRP B. subtilis, Japan]
BKE37510 (Δ[gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACGGGTTCCCCCTTTT,  downstream forward: _UP4_TGAAAATAACCCGGCTCCTC
BKK37510 (Δ[gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACGGGTTCCCCCTTTT,  downstream forward: _UP4_TGAAAATAACCCGGCTCCTC
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jeff Errington] lab
GFP fusion
3510 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]::pSG5309 (cat Pxyl-gfpa-[gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]1-544) [pubmed|15758244], available in [wiki|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
References
Reviews
33709487
Original Publications
16497325,11567005,10767540,20525796,15758244,19458048,29456081

BDC2D775CCE7C06F5619BAC214F29CFC637FE804

Page visits: 2910

Time of last update: 2023-02-04 20:49:41

Author of last update: Jstuelk