SubtiWiki SubtiWiki
ytzE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytzE
168

similar to transcriptional regulator ([wiki|DeoR family])

locus
BSU_30020
Molecular weight
8.36 kDa
pI
10.52
Protein length
Gene length
function
unknown
product
putative transcription factor
essential
no
synonyms
ytzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
3,072,401 → 3,072,622
The protein
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 8-63) (according to UniProt)
Structure
[PDB|4HX4] ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR], 26% identity) [pubmed|23298157]
Biological materials
Mutant
BKE30020 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACCACTCCCTATCA,  downstream forward: _UP4_TAAATTGAAAATTACATAGG
BKK30020 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACCACTCCCTATCA,  downstream forward: _UP4_TAAATTGAAAATTACATAGG
GP2583 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::tet comIQ12L) (in DK1042) available at [wiki|Jörg Stülke]'s lab
References
Research papers
23298157

BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA

Page visits: 696

Time of last update: 2022-01-26 15:48:00

Author of last update: Melvin.boenninger