cheD

cheD
168

chemoreceptor deaminase, required for methylation of methyl-accepting chemotaxis proteins by [protein|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR], enhances phosphatase activity of [protein|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC], required for full [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC] activity

locus
BSU_16460
Molecular weight
17.86 kDa
pI
9.35
Protein length
Gene length
function
[wiki|motility and chemotaxis]
product
protein deaminase, [protein|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC] activity modulator
essential
no
ec
3.5.1.44
synonyms
cheD, ylxK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1871

This gene is a member of the following regulons

Gene
Coordinates
1,715,970 → 1,716,470
Phenotypes of a mutant
not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
binds chemoreceptors and increases their ability to activate the kinase activity of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] [Pubmed|23226535]
H2O + L-glutaminyl-[protein] --> L-glutamyl-[protein] + NH4+ (according to UniProt)
deaminates Gln-586, Gln-593, and Gln594 in [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA] [Pubmed|22931217]
deaminates Gln-609 in [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC] [Pubmed|22931217]
Protein family
CheD family (single member, according to UniProt)
Structure
[PDB|2F9Z] (from Thermotoga maritima, 41% identity) [pubmed|16469702]
[AF|P40404]
Expression and Regulation
Operons
genes
[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|20233303]
regulation
see [wiki|fla-che operon]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|20233303], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2022-11-27 23:44:48

Jstuelk

68

EECFE9022742ECC57D9BBA5CE7DB7A4D1BFD42A8

0535E3D13CBD000A94D62050515BF8D1D5E3F011

genes
[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|9657996,8157612,15175317]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|9657996], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2022-11-28 09:06:45

Jstuelk

57

024d59ae468aa14568753f57122b789c39ed6c06

4D920B925DA071AE7390E022B9AB625E40B7B2AC

Biological materials
Mutant
1A861 ( ''cheD''::''cat''), [Pubmed|7893679], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A861&Search=1A861 BGSC]
1A863 ( ''cheD''::''cat''), [Pubmed|7893679], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A863&Search=1A863 BGSC]
DS6868 (marker-less in NCIB3610) [Pubmed|25313396]
BKE16460 (Δ[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATAACAACAGCCTCAGTTG,  downstream forward: _UP4_TAATTAAGGTATTAGGGGGA
BKK16460 (Δ[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATAACAACAGCCTCAGTTG,  downstream forward: _UP4_TAATTAAGGTATTAGGGGGA
References
Reviews
18774298,18990184
Original Publications
25313396,26122431,17850253,21515776,22931217,23226535,7893679,15317802,17908686,12011078,8866475,11722727,9194713,14651647,9657996,8157612,15175317,16469702,24386445,25039821,16469702,35638827

BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE

Page visits: 1391

Time of last update: 2022-11-28 10:01:45

Author of last update: Jstuelk