rhgR

rhgR
168

transcriptional activator ([wiki|AraC family]) of the rhamnogalacturonan operon

locus
BSU_07010
Molecular weight
87.56 kDa
pI
7.77
Protein length
Gene length
function
regulation of pectin utilization
product
transcriptional activator of the rhamnogalacturonan operon
essential
no
synonyms
rhgR, yesS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2207

This gene is a member of the following regulons

Gene
Coordinates
765,838 → 768,123
The protein
Protein family
[wiki|AraC family]
[wiki|Domains]
[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-binding domain: aa 406 - 510 [Pubmed|19651770]
[wiki|HTH araC/xylS-type domain] (aa 659-756) (according to UniProt)
Structure
[AF|O31522]
Effectors of protein activity
interaction with [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr(His)-P]]] (occurs in the absence of preferred carbon sources) stimulates YesS activity [Pubmed|19651770]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]-[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
description
[Pubmed|22383849]
regulation
induced by pectin ([protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR], [protein|F09661C8A483D0FC796204102021104A4373F895|rhgL]) [Pubmed|19651770,35881471]
repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [pubmed|35881471]
regulatory mechanism
[protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]: activation, [Pubmed|19651770], in [regulon|protein:BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: Sigma factor, [pubmed|35881471], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|F09661C8A483D0FC796204102021104A4373F895|rhgL]: activation, [pubmed|35881471], in [regulon|protein:F09661C8A483D0FC796204102021104A4373F895|rhgL regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|35881471], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]→[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]

2022-12-04 00:23:36

Jstuelk

43

D891C8F38E150B653BA655BA6352352D86D18BAE

A10D4124F5AF6831808648D33C98AF061D3703AA

Biological materials
Mutant
MGNA-B450 (yesS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1449 NBRP B. subtilis, Japan]
BKE07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC,  downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
BKK07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC,  downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
References
19651770,17449691,21630458,24391637

BF0E202739BFD461E418655ECD9C3425AC556FA3

Page visits: 2835

Time of last update: 2022-12-06 03:15:48

Author of last update: Melvin.boenninger