tasA

tasA
168

major component of biofilm matrix, forms amyloid fibers

locus
BSU_24620
Molecular weight
28.15 kDa
pI
5.44
Protein length
Gene length
function
[wiki|biofilm formation]
product
major component of biofilm matrix
essential
no
synonyms
tasA, cotN, yqhF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5884

This gene is a member of the following regulons

Gene
Coordinates
2,553,081 → 2,553,866
Phenotypes of a mutant
altered cell death pattern in colonies [Pubmed|23012477]
increases membrane fluidity and cell death [pubmed|32313019]
failure to produce structured and wrinkled colonies [pubmed|33803642]
The protein
Catalyzed reaction/ biological activity
forms amyloid fibers that bind cells together in the biofilm [Pubmed|20080671]
Protein family
peptidase M73 family (single member, according to UniProt)
Structure
[PDB|5OF1] [pubmed|29531041]
[PDB|5OF2] [pubmed|29531041]
[AF|P54507]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862], secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW] [Pubmed|10049401]
Expression and Regulation
Operons
genes
[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
description
[Pubmed|16430695]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10464223,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: activation, [Pubmed|24196425], in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16430695], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
Open in new tab

[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]→[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]

2022-11-22 14:18:09

Jstuelk

64

5d4b2839ae781570552ba6a28b48e7489d628dd2

25F0FAE210D5101B1935E4625742633C173FC509

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-C449 (yqhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2447 NBRP B. subtilis, Japan]
BKE24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA,  downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
BKK24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA,  downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
References
Reviews
20735481,20351052,21488983,24988880,25907113,26418850,28783117,30098341,33239434,33824496
Original Publications
23352144,23352134,23632024,23012477,21815947,21856853,18047568,16430695,16430696,10368135,18430133,18647168,10464223,17720793,18957862,12107147,20080671,10049401,23646920,24488317,25894589,26883633,29531041,29565118,29590605,29802781,29887307,29921978,30297741,30833350,31370706,32313019,32430292,32491277,32753507,32779018,33033811,33803642,33806534,33803642,34492253,35098894,36330326

BF97457E986656E4A9FE7A858F5BDF1759850D5C

Page visits: 9801

Time of last update: 2022-11-27 04:24:18

Author of last update: Jstuelk