ydaF

ydaF
168

similar to acetyltransferase

locus
BSU_04210
Molecular weight
20.88 kDa
pI
5.56
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydaF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1670

This gene is a member of the following regulons

Gene
Coordinates
473,174 → 473,725
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 10-176) (according to UniProt)
Structure
[PDB|1NSL]\t[Pubmed|15468321]
[AF|P96579]
Paralogous protein(s)
[protein|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]
Expression and Regulation
Operons
genes
[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|22383849]
Open in new tab

[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2022-11-16 12:42:45

Jstuelk

18

274d05bc99b84129af0dc4c123bf28394b0935e6

27CF20D9A51B37DB84B21F3DD0F0554697F8DAF7

genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2022-11-29 14:15:58

ghost

27

0f01f3d4a72c13fc2bd8814fcb16a6972198e29f

A2B50F578CB3D7FDB3773EE82697C8F07A97C986

Biological materials
Mutant
MGNA-C088 (ydaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2086 NBRP B. subtilis, Japan]
BKE04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC,  downstream forward: _UP4_TAAAGAGCACACTTTCTTGT
BKK04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC,  downstream forward: _UP4_TAAAGAGCACACTTTCTTGT
References
10220166,18840696,15468321

BFDAB855DC76A78C100DC5E5FB81F73069F5F93F

Page visits: 1031

Time of last update: 2022-12-01 19:23:08

Author of last update: Melvin.boenninger