SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


similar to acetyltransferase

Molecular weight
20.88 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1670

This gene is a member of the following regulons

473,174 → 473,725
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|N-acetyltransferase domain] (aa 10-176) (according to UniProt)
[PDB|1NSL] [Pubmed|15468321]
Paralogous protein(s)
Expression and Regulation
Open in new tab


2021-11-26 16:59:18





induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2021-11-07 02:24:45





Biological materials
MGNA-C088 (ydaF::erm), available at the [ NBRP B. subtilis, Japan]
BKE04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC,  downstream forward: _UP4_TAAAGAGCACACTTTCTTGT
BKK04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC,  downstream forward: _UP4_TAAAGAGCACACTTTCTTGT


Page visits: 864

Time of last update: 2022-01-13 13:26:40

Author of last update: Melvin.boenninger