SubtiWiki SubtiWiki
purT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

purT
168

phosphoribosylglycinamide formyltransferase 2

locus
BSU_02230
Molecular weight
41.93 kDa
pI
4.72
Protein length
Gene length
function
purine biosynthesis
product
phosphoribosylglycinamide formyltransferase 2
essential
no
ec
null
synonyms
purT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0027

This gene is a member of the following regulons

Gene
Coordinates
243,892 → 245,046
The protein
Catalyzed reaction/ biological activity
ATP + formate + N1-(5-phospho-D-ribosyl)glycinamide --> ADP + H+ + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
Protein family
PurK/PurT family (with [protein|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK], according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp domain] (aa 111-300) (according to UniProt)
Structure
[PDB|1KJ9] (with Mg-ATP from ''Escherichia coli'', 55% identity, 69% similarity) [Pubmed|11953435]
Paralogous protein(s)
[protein|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]
Expression and Regulation
Operons
genes
[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7496533], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]

2021-06-26 17:33:08

Jstuelk

2

97a7ba575c5734599c7d2e2a4b7a0578cfc398ea

45D484ADB7FB6E21B4FB6C85C8E037979AA362C4

Biological materials
Mutant
BKE02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT,  downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG
BKK02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT,  downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG
References
7496533

C00E34EF63B5EAE33CAD5E469893C0A5112B9F35

Page visits: 1169

Time of last update: 2022-01-19 03:28:47

Author of last update: Melvin.boenninger