

phosphoribosylglycinamide formyltransferase 2

Molecular weight
41.93 kDa
Protein length
Gene length
purine biosynthesis
phosphoribosylglycinamide formyltransferase 2

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0027

This gene is a member of the following regulons

243,892 → 245,046
The protein
Catalyzed reaction/ biological activity
ATP + formate + N1-(5-phospho-D-ribosyl)glycinamide --> ADP + H+ + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
Protein family
PurK/PurT family (with [protein|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK], according to UniProt)
[wiki|ATP-grasp domain] (aa 111-300) (according to UniProt)
[PDB|1KJ9] (with Mg-ATP from ''Escherichia coli'', 55% identity, 69% similarity) [Pubmed|11953435]
Paralogous protein(s)
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7496533], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-09-19 16:23:31





Biological materials
BKE02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT,  downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG
BKK02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT,  downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG


Page visits: 1316

Time of last update: 2022-09-23 16:08:17

Author of last update: Melvin.boenninger