SubtiWiki SubtiWiki
yyaJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yyaJ
168

unknown

locus
BSU_40840
Molecular weight
49.51 kDa
pI
9.58
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yyaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
4,194,389 → 4,195,744
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]
description
[pubmed|22383849]
Open in new tab

[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]

2021-06-23 21:17:59

Jstuelk

1

93b806363b7b31e9f85ddcb01edaaa2b517370b6

F6A92D704B33D76473A16B0823C413B2EAE28C65

Biological materials
Mutant
MGNA-B864 (yyaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1863 NBRP B. subtilis, Japan]
BKE40840 (Δ[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCCCTTTTGA,  downstream forward: _UP4_TAAAAAAGTCAGTGCGGATC
BKK40840 (Δ[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCCCTTTTGA,  downstream forward: _UP4_TAAAAAAGTCAGTGCGGATC

C09526985A4FFEE49DFBF754FAED845CA86CCC14

Page visits: 718

Time of last update: 2022-01-20 16:12:43

Author of last update: Melvin.boenninger