phrC

phrC
168

response regulator aspartate phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)

locus
BSU_03780
Molecular weight
4.06 kDa
pI
8.16
Protein length
Gene length
function
control of ComA activity
product
phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)
essential
no
ec
null
synonyms
phrC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
429,963 → 430,085
The protein
Catalyzed reaction/ biological activity
binds to [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC], this results in the inability of [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC] to interact with [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] [Pubmed|12950917]
Protein family
[wiki|phr family] (according to UniProt)
Structure
[PDB|4GYO] (complex [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]-[protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]) [Pubmed|23526881]
[AF|P94416]
Expression and Regulation
Operons
genes
[gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]-[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
description
[Pubmed|10464187]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|10464187], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10464187], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|10464187], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]→[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]

2022-12-02 07:46:33

ghost

22

d557cd87272a9075c3ffbe931e4b5edeb40e54a7

4C234676BFA582602106F93B45E171FF3EF2C098

genes
[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
description
[Pubmed|10464187]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
Open in new tab

[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]

2022-12-08 11:33:17

ghost

19

0c4c2871826072f696f4a92077c61b43ea5b999b

8E7ED77CC8409D333846B8D228772A45BC29098C

Biological materials
Mutant
BKE03780 (Δ[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACTTAGATTTCAATTTCATA,  downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA
BKK03780 (Δ[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACTTAGATTTCAATTTCATA,  downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA
References
Reviews
22024380
Original Publications
12950917,16816200,19202088,18375560,11267663,10464187,12850135,16091051,23526881,22511326

C0B7845F55A16300EB37F026C817AEC4F3BA3B6F

Page visits: 2580

Time of last update: 2022-12-09 07:22:44

Author of last update: Melvin.boenninger