ykuT

ykuT
168

mechanosensitive channel, similar to MscS, general stress protein

locus
BSU_14210
Molecular weight
29.88 kDa
pI
5.65
Protein length
Gene length
function
resistance to osmotic downshock
product
anion-selective mechanosensitive channel of small conductance
essential
no
synonyms
ykuT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0668

This gene is a member of the following regulons

Gene
Coordinates
1,491,221 → 1,492,024
The protein
Protein family
[wiki|MscS (TC 1.A.23) family] (according to UniProt)
Structure
[PDB|3T9N] (from Thermoanaerobacter tengcongensis, 40% identity) [pubmed|23074248]
[AF|O34897]
[wiki|Localization]
cell membrane [Pubmed|19252899]
Expression and Regulation
Operons
genes
[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]

2022-06-15 09:56:22

Bzhu

13

92dc47a30f277ac4a594996a926f3cb4ab5b86eb

4F8A20A4C36464631C227F474996E93B40623EAD

Biological materials
Mutant
MGNA-B342 (ykuT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1341 NBRP B. subtilis, Japan]
1A960 ( ''ykuT''::''cat''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A960&Search=1A960 BGSC]
BKE14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA,  downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
BKK14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA,  downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
References
Reviews
12626684,22685280,22404681,24607989,17505523,33244613
Original Publications
17665170,18310427,19252899,11544224,23074248,33568813
Labs working on this gene/protein
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3

Page visits: 1678

Time of last update: 2022-06-26 10:29:52

Author of last update: Jstuelk