SubtiWiki SubtiWiki
liaF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

liaF
168

inhibitor of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS] kinase activity

locus
BSU_33100
Molecular weight
26.88 kDa
pI
9.21
Protein length
Gene length
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR] activity
product
negative effector of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]
essential
no
synonyms
liaF, yvqF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4758

This gene is a member of the following regulons

Gene
Coordinates
3,396,114 → 3,396,839
The protein
Catalyzed reaction/ biological activity
inhibitor of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS] kinase activity, maintains [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS] in the phosphatase state in the absence of the stress signal [Pubmed|23279150]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|16816187]
regulation
''[protein|search|liaG]'': constitutive
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15273097], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2021-11-08 20:05:10

ghost

8

2f16b4fd354512d8414b5b6145620bdeaa475d46

AF84222759CC1E14AC8022D48DBA6522494204CA

genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|14651641]
regulation
''[protein|search|liaG]'': constitutive
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2021-11-02 15:17:31

ghost

11

844f52131490c84c9a0558a221a24520579ef3fd

F37C9323D2117C9590CDC8EC3E6B0E3F58AFC1F7

Biological materials
Mutant
MGNA-B037 (yvqF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1036 NBRP B. subtilis, Japan]
BKE33100 (Δ[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTGGTGTCCGCCTCC,  downstream forward: _UP4_GGTGATGTGGATGTGAAGTA
BKK33100 (Δ[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTGGTGTCCGCCTCC,  downstream forward: _UP4_GGTGATGTGGATGTGAAGTA
References
Reviews
27344142
Original Publications
19164152,20639339,15273097,17660417,16816187,15101989,17660417,16816187,23279150,20817675,22092710,23326432,33114184

C107A958DFA2B0DA4837E2F9F648CD329A3116AC

Page visits: 1780

Time of last update: 2022-01-17 13:43:36

Author of last update: Jstuelk