ccpB

ccpB
168

transcriptional regulator ([wiki|LacI family])

locus
BSU_40870
Molecular weight
34.69 kDa
pI
6.33
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|LacI family])
essential
no
synonyms
ccpB, yyaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
4,196,786 → 4,197,721
The protein
Protein family
[wiki|LacI family]
[wiki|Domains]
[wiki|HTH lacI-type domain] (aa 1-56) (according to UniProt)
Structure
[PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA], 30% identity) [pubmed|17500051]
[AF|P37517]
Expression and Regulation
Operons
genes
[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]-[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/exoA-ccpA.html DBTBS]) null
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16237020]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16237020], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]→[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]

2022-12-29 22:40:47

ghost

50

3f181edb20420bd1cb614f6c4de3ba54858fe866

B6BAB0747C1B7BA1C01E54A6AE82AD107F48CAD3

Biological materials
Mutant
MGNA-B867 (yyaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1866 NBRP B. subtilis, Japan]
BKE40870 (Δ[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTCTCCTTTTCAT,  downstream forward: _UP4_TGAACTGAAATGCATTTCAT
BKK40870 (Δ[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTCTCCTTTTCAT,  downstream forward: _UP4_TGAACTGAAATGCATTTCAT
References
9457849,16237020,9457849,17500051

C14B113B1A8BEA0547459AA7EC5755634D1A8A88

Page visits: 1825

Time of last update: 2023-02-05 02:49:43

Author of last update: Melvin.boenninger