slrA

slrA
168

negative regulator of the [wiki|fla-che operon], anti-repressor, antagonist [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] for the repression of the [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] and [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] operons

locus
BSU_38229
Molecular weight
6.00 kDa
pI
9
Protein length
Gene length
function
control of motility and biofilm formation
product
antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] and [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR]
essential
no
synonyms
slrA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,923,319 → 3,923,477
RNA
additional information
the mRNA has long 5' and 3' UTRs (170 and 330 nt, respectively) [pubmed|26857544]
The protein
Catalyzed reaction/ biological activity
binding of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] resulting in induction of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-repressed genes and operons [Pubmed|19788541]
[wiki|Domains]
[wiki|Sin domain] (aa 1-38) (according to UniProt)
Structure
[AF|P0C8M5]
Effectors of protein activity
[protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] inhibits activity of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] (i. e. binding to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]) [Pubmed|19788541]
Paralogous protein(s)
[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]
Expression and Regulation
Operons
genes
[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]
description
[pubmed|22383849]
regulatory mechanism
[protein|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]: repression, [Pubmed|18647168,19788541], in [regulon|protein:C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC regulon]
additional information
increased expression in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
half-life of the mRNA: 0.56 min, this increases to 1.06 in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
RNA degradation by [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] is proceeds from the 3' end of the mRNA through the [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]-dependent terminator [Pubmed|35311531,26857544]
transcription termination depends on [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho] [Pubmed|26857544]
Open in new tab

[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]

2022-05-02 23:16:46

Jstuelk

8

D065C538DD2374540994AAB68777DD0B8BAE3B26

B6AFE071BE7A0BC5E2E9A62AB13D29C644E1D21B

Biological materials
Mutant
BKE38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38229 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA,  downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
BKK38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38229 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA,  downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Stülke] lab
References
18647168,19788541,23430750,26857544,22329926,35311531

C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7

Page visits: 3792

Time of last update: 2022-10-03 22:21:31

Author of last update: Jstuelk