ppsE

ppsE
168

plipastatin synthetase

locus
BSU_18300
Molecular weight
144.39 kDa
pI
5.66
Protein length
Gene length
function
production of the antibacterial compound plipastatin
product
plipastatin synthetase
essential
no
synonyms
ppsE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3319

This gene is a member of the following regulons

Gene
Coordinates
1,960,198 → 1,964,037
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
[wiki|Domains]
[wiki|Carrier domain] (aa 975-1050) (according to UniProt)
Structure
[PDB|2VSQ] ([protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC], 40% identity) [pubmed|18583577]
[AF|O31827]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]-[gene|E7A2F93B33B1899313893D362D92405232BC9097|ppsB]-[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]-[gene|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|ppsD]-[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]→[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]

2022-11-24 21:58:46

ghost

22

c24e95905169206a2bb4f32c2e44eb72392e19bb

53EB981BAF3A634ABF820E4DAD645D458FD52A47

Biological materials
Mutant
BKE18300 (Δ[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTGCACCTTTCTTCACGG,  downstream forward: _UP4_TAAAGCGGATTAGCGGACAG
BKK18300 (Δ[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTGCACCTTTCTTCACGG,  downstream forward: _UP4_TAAAGCGGATTAGCGGACAG
References
10471562,9387222,21821766,20817675,28009004,18583577

C1C051209943E02369356075EAA733297E9478CB

Page visits: 2341

Time of last update: 2022-11-28 21:46:11

Author of last update: Melvin.boenninger