rimI

rimI
168

protein N-acetyltransferase

locus
BSU_05930
Molecular weight
17.23 kDa
pI
5.67
Protein length
Gene length
function
acetylation of [protein|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|S18] and [protein|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-Tu]
product
protein N-acetyltransferase
essential
no
ec
2.3.1.128
synonyms
ydiD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0456

This gene is a member of the following regulons

Gene
Coordinates
642,810 → 643,265
The protein
Catalyzed reaction/ biological activity
acetylation of [protein|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|S18] and [protein|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-Tu] [pubmed|35398352]
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 5-150) (according to UniProt)
Structure
[PDB|2CNM] [pubmed|18596200]
[AF|O05517]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|DE32F1DA1EA1164411E0605262381BD38A49656C|thiL]-[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]-[gene|6CB350C335603D5F4434679F9D740BFECA738599|tsaB]-[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|rimI]-[gene|30393F16CFE89E7BAD233A0BD27B77D679F7E409|tsaD]
description
[Pubmed|22383849]
Open in new tab

[gene|DE32F1DA1EA1164411E0605262381BD38A49656C|thiL]→[gene|30393F16CFE89E7BAD233A0BD27B77D679F7E409|tsaD]

2022-11-27 09:14:18

ghost

47

45839886739c513a86015eb2db5091e043ecd558

F160E3DB3BAB4687DBF8F609242CE813EE9E1BF6

Biological materials
Mutant
MGNA-C198 (ydiD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2196 NBRP B. subtilis, Japan]
BKE05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|rimI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT,  downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
BKK05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|rimI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT,  downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
References
22383849,18596200,35398352

C2283BDD806221A285A27F24F52F92F4D47F0C55

Page visits: 1093

Time of last update: 2022-11-26 18:17:15

Author of last update: Jstuelk