SubtiWiki SubtiWiki
rhaEW

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rhaEW
168

bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase

locus
BSU_31220
Molecular weight
75.84 kDa
pI
5.78
Protein length
Gene length
function
utilizatio of rhamnose and rhamnogalacturonan (pectin)
product
bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase
essential
no
synonyms
rhaEW, yulA, yuwG, yuxG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3347

This gene is a member of the following regulons

Gene
Coordinates
3,201,860 → 3,203,929
The protein
Catalyzed reaction/ biological activity
rhamnulose-1-phosphate --> dihydroxyacetone-phosphate + L-lactate [Pubmed|24391637]
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[wiki|Cofactors]
NAD [Pubmed|24391637]
Expression and Regulation
Operons
genes
[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|26712933,22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2022-01-23 03:46:58

ghost

13

19fb437091a8b0a4c85dca603a6b54dd43243683

2050B8CB3997650C17442F14F1C06F783D5E7647

Biological materials
Mutant
MGNA-A638 (yuxG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/638 NBRP B. subtilis, Japan]
BKE31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT,  downstream forward: _UP4_TAGATATATGCTATGATAAA
BKK31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT,  downstream forward: _UP4_TAGATATATGCTATGATAAA
References
26712933,24391637,22383849

C32AE30BF7931D6171E9DE75C67504F81DD0F227

Page visits: 1020

Time of last update: 2022-01-26 11:21:07

Author of last update: Robert.warneke