putR

putR
168

transcriptional activator of the proline utilization operon [gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]

locus
BSU_03230
Molecular weight
47.67 kDa
pI
5.37
Protein length
Gene length
function
regulation of proline utilization
product
transcriptional activator ([wiki|PucR family])
essential
no
synonyms
putR, ycgP, prcR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2508

This gene is a member of the following regulons

Gene
Coordinates
348,724 → 349,959
Phenotypes of a mutant
no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
The protein
Catalyzed reaction/ biological activity
transcription activation of the proline utilization operon ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' in the presence of proline  [Pubmed|21840319,21964733]
Protein family
[wiki|PucR family]
[wiki|CdaR family] (according to UniProt)
[wiki|Cofactors]
proline acts as co-activator  [Pubmed|21840319]
Structure
[AF|P94393]
Effectors of protein activity
proline activates PutR  [Pubmed|21840319]
Expression and Regulation
Operons
genes
[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]
description
[Pubmed|21840319]
regulation
constitutively expressed [Pubmed|21840319,21964733]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21964733], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]

2022-11-18 04:21:27

ghost

11

362880cde7c5582e54923894d48cb82e03ad2a79

348E344031F35926B4894FD90B2F61B36D555EE6

Biological materials
Mutant
BKE03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
BKK03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
References
21840319,21964733,22139509

C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE

Page visits: 2067

Time of last update: 2022-11-29 15:47:00

Author of last update: Melvin.boenninger