ywcC

ywcC
168

transcription repressor ([wiki|TetR family]), controls [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression

locus
BSU_38220
Molecular weight
25.96 kDa
pI
8.47
Protein length
Gene length
function
control of [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression
product
transcription repressor ([wiki|TetR family])
essential
no
synonyms
ywcC, ipa-33d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
3,922,292 → 3,922,963
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 11-71) (according to UniProt)
Structure
[AF|P39601]
Expression and Regulation
Operons
genes
[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]-[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]-[gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]-[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]
description
[Pubmed|22383849,22893383]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
Open in new tab

[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]→[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]

2022-11-18 11:16:27

ghost

26

2c55134f930fd735713cc2b5bc79db8a76ccbb71

EAEF4B4702CF0981CF8DC10BB149EDF4E1FB63DF

Biological materials
Mutant
MGNA-B230 (ywcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1229 NBRP B. subtilis, Japan]
BKE38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT,  downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
BKK38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT,  downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
References
Reviews
24006471
Original Publications
18647168,22383849,22893383,19788541,27891125

C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F

Page visits: 1802

Time of last update: 2022-11-28 17:06:24

Author of last update: Melvin.boenninger