dgcK

dgcK
168

diguanylate cyclase

locus
BSU_09120
Molecular weight
40.53 kDa
pI
8.57
Protein length
Gene length
function
synthesis of c-di-GMP
product
diguanylate cyclase
essential
no
synonyms
dgcK, yhcK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2199

This gene is a member of the following regulons

Gene
Coordinates
985,734 → 986,813
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
[wiki|Domains]
six transmembrane helices at the N-terminus (according to UniProt?)
contains a C-terminal [wiki|GGDEF domain] (aa 223-357) [Pubmed|22821967]
Structure
[PDB|2WB4] (the C-terminal [wiki|GGDEF domain], PleD from Caulobacter vibrioides, 44% identity)
[AF|P54595]
[wiki|Localization]
cell membrane at cell poles and septa, probably close to [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK] [pubmed|28536559]
present at a single site in the cell membrane [pubmed|32156823]
Expression and Regulation
Operons
genes
[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]
description
[pubmed|22383849]
Open in new tab

[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]

2022-11-20 07:08:31

Jstuelk

19

6fb719aec180a2a9f53e5c3e742c0ce6b95965a6

6808C49BF2474851D3EBF58E0AEC973BBEF8D090

Biological materials
Mutant
MGNA-A656 (yhcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/656 NBRP B. subtilis, Japan]
GP848 (''[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]''::''ermC''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
BKE09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA,  downstream forward: _UP4_TGAATTCAATGTTCGAATTC
BKK09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA,  downstream forward: _UP4_TGAATTCAATGTTCGAATTC
References
23893111,22821967,27116468,28536559,32156823

C43AE224400421CCDA7022C915ECC7525E30EB1D

Page visits: 2946

Time of last update: 2022-12-04 03:22:48

Author of last update: Jstuelk