SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


similar to transcriptional regulator ([wiki|MarR family])

Molecular weight
16.28 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

3,749,052 → 3,749,465
The protein
[wiki|HTH marR-type domain] (aa 5-136) (according to UniProt)
[PDB|3NRV] (from Acinetobacter sp., 27% identity)
Biological materials
MGNA-A217 (ywoH::erm), available at the [ NBRP B. subtilis, Japan]
BKE36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA,  downstream forward: _UP4_TGAAAATAAGGAAGTGACAT
BKK36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA,  downstream forward: _UP4_TGAAAATAAGGAAGTGACAT


Page visits: 881

Time of last update: 2022-01-20 16:30:12

Author of last update: Melvin.boenninger