ywoH

ywoH
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_36440
Molecular weight
16.28 kDa
pI
8.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywoH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
3,749,052 → 3,749,465
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 5-136) (according to UniProt)
Structure
[PDB|3NRV] (from Acinetobacter sp., 27% identity)
[AF|P94578]
Biological materials
Mutant
MGNA-A217 (ywoH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/217 NBRP B. subtilis, Japan]
BKE36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA,  downstream forward: _UP4_TGAAAATAAGGAAGTGACAT
BKK36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA,  downstream forward: _UP4_TGAAAATAAGGAAGTGACAT

C44717EB77EBB904451F838B69050D08040B30E2

Page visits: 956

Time of last update: 2022-07-02 03:18:22

Author of last update: Melvin.boenninger