Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.


choline and arsenocholine [wiki|ABC transporter] (binding protein)

Molecular weight
34.25 kDa
Protein length
Gene length
compatible solute transport
choline and arsenocholine [wiki|ABC transporter] (binding protein)
opuBC, proX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1732

This gene is a member of the following regulons

3,460,503 → 3,461,423
The protein
Catalyzed reaction/ biological activity
uptake of choline and arsenocholine [pubmed|29159878]
Protein family
OsmX family (with [protein|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC], according to UniProt)
[PDB|3R6U], [PDB|6EYQ] (in complex with choline) [pubmed|21658392]
[PDB|5NXX] (in complex with arsenocholine) [pubmed|29159878]
[PDB|6EYL] (in complex with carnitine)
[PDB|6EYG] (mutant in complex with betaine)
[PDB|6EYH] (mutant in complex with dimethylsulfoniopropionate)
Paralogous protein(s)
associated to the membrane (via [protein|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[protein|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]) [Pubmed|10092453]
lipoprotein [Pubmed|10216873]
Expression and Regulation
induced by choline ([protein|search|GbsR]) [Pubmed|22408163]
regulatory mechanism
[protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|protein:5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR regulon]
[protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|protein:9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10216873], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An antisense RNA is predicted for'[protein|search|opuBD]' [PubMed|20525796]
Open in new tab


2022-06-21 04:51:49





Biological materials
BKE33710 (Δ[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC,  downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA
BKK33710 (Δ[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC,  downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA
Original Publications


Page visits: 1608

Time of last update: 2022-08-18 11:15:37

Author of last update: Jstuelk