mifM

mifM
168

ribosome-nascent chain sensor of membrane protein biogenesis

locus
BSU_23880
Molecular weight
11.01 kDa
pI
5.83
Protein length
Gene length
function
control of [protein|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2] translation
product
sensor of [protein|search|SpoIIIJ] activity
essential
no
synonyms
mifM, yqzJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,483,586 → 2,483,873
The protein
Catalyzed reaction/ biological activity
acts as a kind of "leader peptide" that does or does not allow translation through a hairpin structure in the ''[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]'' mRNA [Pubmed|19779460]
[wiki|Domains]
N-terminal transmembrane domain [Pubmed|22864117]
the C-terminal domain interacts with the ribosome and arrests the own translation elongation [Pubmed|22864117]
Structure
[PDB|3J9W] ([protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-stalled [wiki|ribosome] complex) [Pubmed|25903689]
[http://www.ebi.ac.uk/pdbe/entry/emdb/EMD-6306 EMD-6306] ([protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-stalled [wiki|ribosome] complex) [Pubmed|25903689]
[AF|Q7WY64]
[wiki|Localization]
membrane [Pubmed|19779460]
Expression and Regulation
Operons
genes
[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]
description
[Pubmed|22383849]
regulation
repressed by large amounts of [wiki|SpoIIIJ], induced by small amounts of [wiki|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
regulatory mechanism
[protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1] levels, in [regulon|protein:C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM regulon]
additional information
An antisense RNA is predicted for '[protein|search|mifM]' [PubMed|20525796]
Open in new tab

[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]→[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]

2022-11-29 01:52:35

ghost

37

f8a6fff082045f34969fcbb9e7dd06a79ebdd148

CF4B91E771854E675A6B5052E8B77F0D2D86EFB9

Biological materials
Mutant
BKE23880 (Δ[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCATTCAATAGC,  downstream forward: _UP4_TAAACCGCATTTATAAAAAG
BKK23880 (Δ[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCATTCAATAGC,  downstream forward: _UP4_TAAACCGCATTTATAAAAAG
References
19779460,21383133,20525796,22456704,22383849,22864117,25313395,25903689,29985442

C50AE06E8C959EB7176504C8E2BAD1A08E47C51A

Page visits: 3785

Time of last update: 2022-11-29 17:27:26

Author of last update: Jstuelk