yaaL

yaaL
168

unknown

locus
BSU_00220
Molecular weight
9.09 kDa
pI
10.33
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yaaL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
29,481 → 29,705
The protein
Structure
[AF|P37533]
Expression and Regulation
Operons
genes
[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
description
[Pubmed|22383849]
Open in new tab

[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]→[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]

2022-12-01 05:47:42

Jstuelk

53

1a32cdecddaee24171f48459041fdcb062bafc36

7EC4B7D4D9D0E5E8848420FD5562059E4207233C

Biological materials
Mutant
MGNA-B893 (yaaL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1892 NBRP B. subtilis, Japan]
BKE00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC,  downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG
BKK00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC,  downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG

C5127208E7562F09249112240F0BE8C582B2E5AD

Page visits: 1035

Time of last update: 2022-11-26 04:32:42

Author of last update: Bzhu