SubtiWiki SubtiWiki
yvbV

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvbV
168

putative cysteine and O-acetyl serine efflux permease

locus
BSU_34000
Molecular weight
32.67 kDa
pI
10.34
Protein length
Gene length
function
unknown
product
putative cysteine and O-acetyl serine efflux permease
essential
no
ec
null
synonyms
yvbV, cyeB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
3,488,952 → 3,489,869
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 18-141, aa 161-287) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]
description
[Pubmed|22383849]
Open in new tab

[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]

2021-10-12 06:33:04

Jstuelk

1

21ba34cddce3414c25e7020a11d5021a044543a6

2D108C268BAC6C358A95AE43733AB726AA5E136D

Biological materials
Mutant
MGNA-A467 (yvbV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/467 NBRP B. subtilis, Japan]
BKE34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG,  downstream forward: _UP4_TAATAAAAACCCTCTTGCCG
BKK34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG,  downstream forward: _UP4_TAATAAAAACCCTCTTGCCG

C691DD957367F10E6C947AE69BB926462391FFDA

Page visits: 910

Time of last update: 2021-12-21 09:42:06

Author of last update: Melvin.boenninger