SubtiWiki SubtiWiki
yvlC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvlC
168

similar to phage shock protein C, involved in resistance to nisin

locus
BSU_35110
Molecular weight
7.33 kDa
pI
9.85
Protein length
Gene length
function
resistance to nisin
product
unknown
essential
no
ec
null
synonyms
yvlC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1983

This gene is a member of the following regulons

Gene
Coordinates
3,607,123 → 3,607,320
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
The protein
Protein family
PspC family
Expression and Regulation
Operons
genes
[gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]-[gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]-[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]-[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]
description
[Pubmed|9987136]
regulation
induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]→[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]

2021-12-09 01:30:12

ghost

4

d2e22f4da116c900e17f9124649ee965bd19db10

152B98D17F45555DCDF115786495B2C3D63C6D79

Biological materials
Mutant
BKE35110 (Δ[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAGCGATAAAGCTTATTCA,  downstream forward: _UP4_CCGTCAGAAAGGGATATGAA
BKK35110 (Δ[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAGCGATAAAGCTTATTCA,  downstream forward: _UP4_CCGTCAGAAAGGGATATGAA
References
12076816,9987136,12207695,220817675,23980836

C6976A38AC0631BD5DF1C294DA7497C76D63193C

Page visits: 996

Time of last update: 2022-01-10 16:51:08

Author of last update: Bzhu