SubtiWiki SubtiWiki
yknV

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yknV
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_14330
Molecular weight
67.75 kDa
pI
6.69
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yknV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1132

This gene is a member of the following regulons

Gene
Coordinates
1,501,658 → 1,503,472
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
[wiki|ABC transmembrane type-1 domain] (aa 45-329) (according to UniProt)
[wiki|ABC transporter domain] (aa 363-597) (according to UniProt)
Structure
[PDB|5MKK] (TmrAB complex from Thermus thermophilus, 35% identity) [pubmed|28069938]
Paralogous protein(s)
[protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA], [protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC], [protein|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA], [protein|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU], [protein|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|ygaD]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]-[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]-[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
description
[Pubmed|22383849]
Open in new tab

[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]→[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]

2022-01-24 11:57:43

Jstuelk

10

974e58c669e1cd698f882bd9e9cd9cf65b440ca0

2DDBCA4C4ACA22DB6536DC6ACAC265E497334729

Biological materials
Mutant
MGNA-B347 (yknV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1346 NBRP B. subtilis, Japan]
BKE14330 (Δ[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTGTTTCATTTGGCCCC,  downstream forward: _UP4_TAATATGAAAAGCCTTCAAT
BKK14330 (Δ[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTGTTTCATTTGGCCCC,  downstream forward: _UP4_TAATATGAAAAGCCTTCAAT
References
10092453,28069938

C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B

Page visits: 799

Time of last update: 2022-01-25 18:49:00

Author of last update: Melvin.boenninger