wapI

wapI
168

immunity protein, protects the cell against the toxic activity of WapA

locus
BSU_39220
Molecular weight
16.29 kDa
pI
4.42
Protein length
Gene length
function
intercellular competition
product
immunity protein
essential
yes
synonyms
wapI, yxxG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,023,054 → 4,023,482
Phenotypes of a mutant
essential [Pubmed|28189581]
severe growth defect  [Pubmed|20815827]
The protein
Catalyzed reaction/ biological activity
[protein|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI] inhibits the toxic activity of [protein|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA] [Pubmed|23572593]
Structure
[AF|Q07836]
Modification
phosphorylation on (Tyr-102 OR Ser-105) [Pubmed|17218307]
Expression and Regulation
Operons
genes
[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]-[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]
description
[Pubmed|16306698]
regulation
repressed at high salt concentration ([protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P) [Pubmed|9537385]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|9537385], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: repression, [Pubmed|23199363], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23199363], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]→[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]

2022-11-18 22:18:07

Jstuelk

37

ACCB16F95EA75BBC03E1DD4186EAB71F0DEDFADE

84D822AFD36349840C746076174D4353AE6A1D3C

Biological materials
Mutant
MGNA-B789 (yxxG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1788 NBRP B. subtilis, Japan]
BKE39220 (Δ[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCTCCTCATTTAA,  downstream forward: _UP4_TAATTATAAATAATTTCTGC
BKK39220 (Δ[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCTCCTCATTTAA,  downstream forward: _UP4_TAATTATAAATAATTTCTGC
References
16672620,20815827,17218307,16306698,9537385,23572593,23199363,26923784,28189581

C7400733DB8835A204A7FF26C87A92A15C5F318C

Page visits: 3069

Time of last update: 2022-12-01 09:19:40

Author of last update: Bzhu