gabR

gabR
168

transcription activator of [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], repressor of [gene|search|gabR ]([wiki|MocR/ GabR family])

locus
BSU_03890
Molecular weight
55.00 kDa
pI
6.71
Protein length
Gene length
function
regulation of gamma-amino butyric acid utilization
product
transcription regulator
essential
no
synonyms
gabR, ycnF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1167

This gene is a member of the following regulons

Gene
Coordinates
440,025 → 441,464
The protein
Catalyzed reaction/ biological activity
transcription activation of the [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD] operon in the presence  of GABA and PLP, transcription repression of [gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR] [Pubmed|15223311]
Protein family
[wiki|MocR/ GabR family] [Pubmed|22020104]
[wiki|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Domains]
N-terminal DNA-binding helix-turn-helix motif (corresponding to domains of the [wiki|GntR family]) [Pubmed|24127574]
C-terminal domain is homologous to PLP-binding large domain of aminotransferases [Pubmed|24127574]
[wiki|HTH gntR-type domain] (aa 14-82) (according to UniProt)
[wiki|Cofactors]
gamma-aminobutyric acid, PLP [Pubmed|31848410,24127574]
Structure
[PDB|4MGR] (the apo-protein) [Pubmed|24127574]
[PDB|4N0B] (the complex with PLP) [Pubmed|24127574]
[AF|P94426]
Effectors of protein activity
activation of ''[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]'' expression is triggered by gamma-amino butyrate and pyridoxalphosphate [Pubmed|15223311]
in the absence of GABA, GabR represses [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD] expression, whereas binding of GABA to GabR results in a conformational change resulting in activation of transcription [pubmed|32147931]
Expression and Regulation
Operons
genes
[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]
description
[pubmed|22383849]
regulatory mechanism
[protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]: negative autoregulation, [Pubmed|12123465], in [regulon|protein:C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12123465], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]

2022-12-01 07:36:08

Jstuelk

22

c17c8cfd4239e1c6001df55dbca3fda04d57fc4d

506000345DBD8D9CB0D46D6A4930AD58E33B5DFD

Biological materials
Mutant
MGNA-C014 (ycnF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2012 NBRP B. subtilis, Japan]
BKE03890 (Δ[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC,  downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
BKK03890 (Δ[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC,  downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
References
11756427,15223311,12123465,24127574,22020104,25388514,25911692,27640111,26681693,28348215,28412355,29253008,31848410,32147931,32413777,36091463

C7C36FAC0CE72226960FC7E8E016B8EC77AF1036

Page visits: 4766

Time of last update: 2022-12-06 04:01:56

Author of last update: Jstuelk