ydgF

ydgF
168

similar to amino acid permease

locus
BSU_05620
Molecular weight
50.63 kDa
pI
9.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydgF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1113

This gene is a member of the following regulons

Gene
Coordinates
606,699 → 608,075
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|6F34] (from Geobacillus kaustophilus, the C-terminal domain, aa 203-458, 26% identity) [pubmed|29416041]
[AF|P96704]
Paralogous protein(s)
[protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|alaP], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]
description
[Pubmed|22383849]
Open in new tab

[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]

2022-11-23 01:03:32

Jstuelk

24

418b850d4e16201fd72dd12cf89c8964c0376872

E4EA8735E446E55F5F2450CA86DDB3040E8EDA05

Biological materials
Mutant
GP3610 GP3595 (erm), available in [wiki|Jörg Stülke]'s lab
GP2930 (Δ[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]::cat) available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-C084 (ydgF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2082 NBRP B. subtilis, Japan]
BKE05620 (Δ[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTATGTGTTCCTCCAT,  downstream forward: _UP4_TAAGACTCAAAACTCCTGCC
BKK05620 (Δ[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTATGTGTTCCTCCAT,  downstream forward: _UP4_TAAGACTCAAAACTCCTGCC
References
20525796,29416041

C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E

Page visits: 1636

Time of last update: 2022-11-27 10:09:28

Author of last update: Jstuelk