yoaR

yoaR
168

unknown

locus
BSU_18720
Molecular weight
33.93 kDa
pI
9.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yoaR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2720

This gene is a member of the following regulons

Gene
Coordinates
2,041,928 → 2,042,839
The protein
Structure
[AF|O34611]
Expression and Regulation
Operons
genes
[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]-[gene|1C01BD9A19036C9897ED6D8BFAFE7E7E77A29C3C|yozF]-[gene|DCA56BBD34F988F16FBF9E67C0C85975E052D96C|yozT]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]→[gene|DCA56BBD34F988F16FBF9E67C0C85975E052D96C|yozT]

2022-12-11 10:54:39

Jstuelk

16

5d7b895779ddc0e6be7529b484fb24119efdb5e6

6F818F01C5A2E786119B051AB7C4943C32E6A778

genes
[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]

2022-12-14 11:43:48

ghost

15

20ba9dba55500abf841c2e758bf74901d5f407be

F642F03280D9059C531DE9B0AF09D66248542F37

Biological materials
Mutant
MGNA-A844 (yoaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/844 NBRP B. subtilis, Japan]
BKE18720 (Δ[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCGGTTTACCTCCC,  downstream forward: _UP4_TAAAGACAAAACCTCAGGTA
BKK18720 (Δ[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCGGTTTACCTCCC,  downstream forward: _UP4_TAAAGACAAAACCTCAGGTA
References
15699190,16497325

C84D95CFF23CE8206182C4111ACDCE3E51A6B201

Page visits: 1193

Time of last update: 2023-02-04 11:52:07

Author of last update: Bzhu