ydfH

ydfH
168

two-component sensor kinase, control of [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ] expression

locus
BSU_05410
Molecular weight
46.34 kDa
pI
9.6
Protein length
Gene length
function
control of [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ] expression
product
two-component sensor kinase (NarL family)
essential
no
ec
null
synonyms
ydfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4585

This gene is a member of the following regulons

Gene
Coordinates
587,744 → 588,967
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
4 transmembrane segments
[wiki|Histidine kinase domain] (aa 201-402) (according to UniProt)
Structure
[PDB|5IUN] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK], C-terminal [wiki|Histidine kinase domain], 28% identity) [pubmed|27938660]
[AF|P96685]
Modification
autophosphorylation on a His residue
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]-[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
description
[Pubmed|15941986]
Open in new tab

[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]→[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]

2022-11-20 12:53:38

ghost

29

f26084e95d34ac9ca538739cbbe65845a203d81d

4EECCA8F59C822E9AD4F1E1A51CBD5C226501351

Biological materials
Mutant
MGNA-C300 (ydfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2298 NBRP B. subtilis, Japan]
BKE05410 (Δ[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTATCCACTTCCTT,  downstream forward: _UP4_AAGATGAATAAGGTTTTAAT
BKK05410 (Δ[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTATCCACTTCCTT,  downstream forward: _UP4_AAGATGAATAAGGTTTTAAT
References
10094672,15941986,27938660

C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C

Page visits: 1802

Time of last update: 2022-11-29 11:59:04

Author of last update: Jstuelk