frlB

frlB
168

fructoselysine-6-P-glycosidase

locus
BSU_32610
Molecular weight
36.72 kDa
pI
5.44
Protein length
Gene length
function
metabolism of aminoacylated fructose
product
fructoselysine-6-P-glycosidase
essential
no
synonyms
frlB, yurP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2222

This gene is a member of the following regulons

Gene
Coordinates
3,351,110 3,352,096
The protein
[wiki|Domains]
2 [wiki|SIS domain]s (aa 15-153, aa 181-311) (according to UniProt)
Structure
[PDB|3EUA]
[AF|O32157]
Modification
phosphorylated on Arg-48 [Pubmed|22517742]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]
description
[Pubmed|23175651,21347729,22383849]
regulation
'' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12618455]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]: repression, [Pubmed|21398478], in [regulon|protein:412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
Open in new tab

[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]→[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]

2022-11-26 22:29:58

Jstuelk

35

1386d0b18bc93ba0b08e1c36531a0379aa199ac3

218EAE44649CE3CDE2633AF97E4CC56ABC5AA2E3

genes
[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]
description
[Pubmed|23175651]
regulation
'' [protein|search|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
Open in new tab

[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]

2022-11-22 22:53:20

ghost

22

6f545c025b50310a628d8db60a8df51a0ef7a4ce

DBAF12DE789DB131AB5059743664BD1CC1257D77

Biological materials
Mutant
MGNA-A594 (yurP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/594 NBRP B. subtilis, Japan]
BKE32610 ([gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
BKK32610 ([gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
References
22517742,23175651,21815947,15556630,18083814,12618455,21347729,18763711,21398478,15378759

C87E74FB67B53DD1C68916AA121388C60CE66E92

Page visits: 3174

Time of last update: 2022-11-27 11:27:35

Author of last update: Melvin.boenninger