ycnE

ycnE
168

putative monooxygenase

locus
BSU_03870
Molecular weight
10.81 kDa
pI
4.87
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycnE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1359

This gene is a member of the following regulons

Gene
Coordinates
439,282 → 439,569
The protein
Protein family
LsrG family (single member, according to UniProt)
[wiki|Domains]
[wiki|ABM domain] (aa 2-93) (according to UniProt)
Structure
[PDB|1X7V] (from Pseudomonas aeruginosa, 38% identity) [pubmed|16049913]
[AF|P94425]
Modification
phosphorylation on Ser-24 [Pubmed|17218307]
Expression and Regulation
Operons
genes
[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]-[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]
description
[Pubmed|17407181]
regulation
induced by chromanon [Pubmed|17407181]
Open in new tab

[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]→[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]

2022-11-24 23:49:41

ghost

26

e9d4126e92ae935ad269e47c6892f92b05cdcc20

1D242F7913BFE3D4943FA50E6CCDD71912D63817

Biological materials
Mutant
BKE03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG,  downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
BKK03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG,  downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
References
17407181,17218307,16049913

C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA

Page visits: 966

Time of last update: 2022-11-27 10:43:10

Author of last update: Melvin.boenninger