spoIIAB

spoIIAB
168

anti-[wiki|sigma factor] to [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF], protein serine kinase, phosphorylates [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]

locus
BSU_23460
Molecular weight
16.21 kDa
pI
4.38
Protein length
Gene length
function
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] activity; phosphorylation and inactivation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]
product
anti-[wiki|sigma factor], protein serine kinase
essential
no
synonyms
spoIIAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2172

This gene is a member of the following regulons

Gene
Coordinates
2,444,208 → 2,444,648
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]
negative regulator (by binding) of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
Protein family
anti-sigma-factor family (with [protein|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW], according to UniProt)
Structure
[PDB|1L0O] (complex with [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF], Geobacillus stearothermophilus) [pubmed|11955433]
[PDB|1TIL] (complex with [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA], Geobacillus stearothermophilus) [pubmed|15236958]
[AF|P10728]
Expression and Regulation
Operons
genes
[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2023-01-25 05:05:10

ghost

50

64b4f19f43ec57e308620c649e41be0eaadae6be

781B7F1839769E51F61804AF186C6D2AF7A0DA95

genes
[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]-[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2023-02-06 13:36:47

ghost

60

3937ee398a65a809f372c4c59231b1d2e3c32629

AEBA18A2591E8C2953E0D2D62B0F6CD480E5CB2B

Biological materials
Mutant
BKE23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT,  downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
BKK23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT,  downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
labs
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
31350897,34438398,34500011,35638784
Original Publications
8358793,7570023,15023063,15351644,8460142,9077448,12923101,8820658,10864495,16824103,12867473,8955289,10476035,8764398,8764397,14744853,9826498,9826499,15175314,1938874,12676949,8126438,11684022,8846916,1948031,3114419,11846550,15201047,2123551,15205443,8885263,8332059,8168129,11701124,8824593,1556084,15687200,20817675,25278935,11955433,15236958

C8B867758330355F44C63CC284DC7AA3061FB9F1

Page visits: 2510

Time of last update: 2023-02-05 21:48:55

Author of last update: Jstuelk