rapK

rapK
168

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity

locus
BSU_18910
Molecular weight
43.68 kDa
pI
5.06
Protein length
Gene length
function
control of [protein|search|ComA ]activity
product
response regulator aspartate phosphatase
essential
no
synonyms
rapK, yobG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,062,150 → 2,063,265
The protein
Catalyzed reaction/ biological activity
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity [Pubmed|16816200]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I1A] ([protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI], 30% identity) [pubmed|23526881]
[AF|O34930]
Effectors of protein activity
binding of [protein|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK] inhibits RapK activity [Pubmed|16816200]
Expression and Regulation
Operons
genes
[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]-[gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]
description
[Pubmed|11466295]
regulation
induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|25666134], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]→[gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]

2022-11-23 05:19:16

ghost

21

8d895f48048c3161ae8450d01604896491e79a76

6598D6175EA141389297C4D92A255AF6C17C57FA

Biological materials
Mutant
BKE18910 (Δ[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG,  downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT
BKK18910 (Δ[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG,  downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT
References
11466295,16816200,20817675,25225273,25666134,23526881

C8BF3815578293542D14811C60F4CA78AACF73EB

Page visits: 3572

Time of last update: 2022-12-08 09:48:24

Author of last update: Melvin.boenninger