azlC

azlC
168

amino acid exporter (with [protein|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD])

locus
BSU_26710
Molecular weight
28.22 kDa
pI
9.73
Protein length
Gene length
function
export of amino acids
product
component of amino acid transporter (with [protein|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD])
essential
no
synonyms
azlC, yrdH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1296

This gene is a member of the following regulons

Gene
Coordinates
2,728,976 → 2,729,740
The protein
Catalyzed reaction/ biological activity
export of some branched-chain amino acids and of histidine (in complex with [protein|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]) [pubmed|36377869]
Protein family
azlC family (single member, according to UniProt)
Structure
[AF|O07942]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
description
[Pubmed|36377869,9287000]
regulation
repressed by [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] [Pubmed|36377869,9287000]
regulatory mechanism
[protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]: repression, [Pubmed|36377869,9287000], in [regulon|protein:D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB regulon]
Open in new tab

[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]→[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]

2022-12-01 22:01:55

Jstuelk

29

CE7A54721725B20F53C4F64C9153F7B05416307A

77D75B92D3B22CF1350DD9E108E868095EE55DEB

Biological materials
Mutant
GP3601 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''kan'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3622 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''kan'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3623 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''spec'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
BKE26710 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAACAACCTCCTACA,  downstream forward: _UP4_GTATGACGATGACTATGACG
BKK26710 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAACAACCTCCTACA,  downstream forward: _UP4_GTATGACGATGACTATGACG
References
9287000,12081967,12879215,36377869

C90D642197EE589F9D33CD5AA0B1069E3BC124A8

Page visits: 1827

Time of last update: 2022-12-06 08:12:52

Author of last update: Jstuelk