yrrD

yrrD
168

forespore-specific sporulation protein

locus
BSU_27470
Molecular weight
19.59 kDa
pI
7.1
Protein length
Gene length
function
unknown
product
forespore-specific sporulation protein
essential
no
synonyms
yrrD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3881

This gene is a member of the following regulons

Gene
Coordinates
2,805,704 → 2,806,228
The protein
Structure
[AF|O34402]
Expression and Regulation
Operons
genes
[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]-[gene|B0618930B934C203FA384E7D7C0D3C1AC399062E|yrzR]-[gene|A4EB284F6BCF0ECFEA9299390D09B10CA689FDDC|yrzQ]
description
[pubmed|22383849]
Open in new tab

[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]→[gene|A4EB284F6BCF0ECFEA9299390D09B10CA689FDDC|yrzQ]

2023-02-01 03:52:52

Jstuelk

15

8e36874333c8f74629422895a3e1294aba17ad3b

786D69C10415DC192D0FFA4A2ACAC00B5C3C9A67

genes
[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]

2022-12-14 21:49:25

ghost

13

e216ff777cb6325a44509cf6db0ac7500937c38e

EADB95693DD457FDF53A079EB12DCE2DE002B304

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-A857 (yrrD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/857 NBRP B. subtilis, Japan]
BKE27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC,  downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
BKK27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC,  downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
References
16497325,30782632

C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA

Page visits: 1076

Time of last update: 2023-02-04 20:42:09

Author of last update: Jstuelk