papB

papB
168

Xaa-Pro amino-peptidase

locus
BSU_13860
Molecular weight
40.18 kDa
pI
5.17
Protein length
Gene length
function
degradation of proline-containing peptides
product
Xaa-Pro amino-peptidase
essential
no
ec
3.4.11.9
synonyms
papB, ykvY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0006

This gene is a member of the following regulons

Gene
Coordinates
1,453,691 → 1,454,782
The protein
Protein family
peptidase M24B family (with [protein|33886A1EAC13B684E92BF94201C46617AD2844B3|papA], according to UniProt)
Structure
[PDB|3Q6D] (''B. anthracis'' Xaa-Pro dipeptidase, 35% identity, 55% similarity)
[AF|O31689]
Paralogous protein(s)
[protein|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]
Expression and Regulation
Operons
genes
[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]
description
[Pubmed|22383849]
Open in new tab

[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]

2022-11-26 05:49:24

Jstuelk

14

204ab4615bf960892e38be28ee4376b11819b7f7

1BCB6CD88C206078330D991B298646007E360030

genes
[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]-[gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]-[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]
description
[Pubmed|22383849]
Open in new tab

[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]→[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]

2022-12-07 16:54:32

Jstuelk

19

25102c23992d19390a5e8e4804e2cbb1f6144844

98F4AE67839A721B68CFC3DAE296D719BD229B45

Biological materials
Mutant
MGNA-B330 (ykvY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1329 NBRP B. subtilis, Japan]
BKE13860 (Δ[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCTTGTTCCTCCCTGC,  downstream forward: _UP4_TAATAGAAATAAAAAAGGAC
BKK13860 (Δ[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCTTGTTCCTCCCTGC,  downstream forward: _UP4_TAATAGAAATAAAAAAGGAC
References
23144141

C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4

Page visits: 1556

Time of last update: 2022-12-08 14:34:48

Author of last update: Melvin.boenninger