gdh

gdh
168

glucose 1-dehydrogenase (NAD)

locus
BSU_03930
Molecular weight
27.94 kDa
pI
5.08
Protein length
Gene length
function
germination
product
glucose 1-dehydrogenase (NAD)
essential
no
ec
1.1.1.47
synonyms
gdh

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
445,344 → 446,129
The protein
Catalyzed reaction/ biological activity
Beta-D-glucose + NAD(P)+ --> D-glucono-1,5-lactone + NAD(P)H (according to UniProt)
Beta-D-glucose + NAD+ --> D-glucono-1,5-lactone + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|3AUS] (from B. megaterium, 83% identity) [pubmed|22804868]
[AF|P12310]
Paralogous protein(s)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], [protein|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]
[protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD], (35,8%)
[protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], (34,8%)
[protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], (34,1%)
[protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|yhxD], (33,5%)
[protein|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF], (53%)
Expression and Regulation
Operons
genes
[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]-[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]
description
[Pubmed|3141376]
regulation
expressed during sporulation ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|3141376,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|3141376], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]→[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]

2022-12-29 08:35:43

ghost

39

16e0c9c3bee64d8f63243f9c4e2bb309da425435

684036B04938AABA3E506CAD88A18F69D2A51153

Biological materials
Mutant
BKE03930 (Δ[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACATATACATCCTCCTCC,  downstream forward: _UP4_TAAACATAAAAAGCGACCCA
BKK03930 (Δ[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACATATACATCCTCCTCC,  downstream forward: _UP4_TAAACATAAAAAGCGACCCA
References
3141376,8755877,21162,2493633,22804868,35638784,36539761

CA4597C6253CCF7D7954686A30AF041808BDF8E5

Page visits: 2808

Time of last update: 2023-02-07 17:31:39

Author of last update: Jstuelk