tenI

tenI
168

thiazole tautomerase

locus
BSU_11660
Molecular weight
22.78 kDa
pI
8.13
Protein length
Gene length
function
biosynthesis of thiamine
product
thiazole tautomerase
essential
no
ec
null
synonyms
tenI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0352

This gene is a member of the following regulons

Gene
Coordinates
1,243,134 → 1,243,751
The protein
Catalyzed reaction/ biological activity
2-[(2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene]ethyl phosphate --> 2-(2-carboxy-4-methylthiazol-5-yl)ethyl phosphate (according to UniProt)
Protein family
thiazole tautomerase family (single member, according to UniProt)
Structure
[PDB|1YAD]
[AF|P25053]
Paralogous protein(s)
[protein|8FAEB6342E087BEDC16FDF5585B03B90ACFF8D11|thiE]
Expression and Regulation
Operons
genes
[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
description
[Pubmed|1898926]
regulation
repressed by thiamine ([wiki|Thi-box]) [Pubmed|16356850]
the [wiki|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [wiki|RNA switch], via [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]→[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]

2022-11-24 21:30:20

Jstuelk

28

a48634f4963321f6f5f59c5107f472325227a1b0

A1FEA45B91FD65F137EB4D1A0FCD88BC91331EAF

Biological materials
Mutant
BKE11660 (Δ[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTAGCTCTTCTACCGGCT,  downstream forward: _UP4_TCCCGCAAGCTAAAGGAGAT
BKK11660 (Δ[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTAGCTCTTCTACCGGCT,  downstream forward: _UP4_TCCCGCAAGCTAAAGGAGAT
References
Reviews
10382260,22616866
Original Publications
15709744,1898926,21534620

CA6AAE8AC5B5EF01A911B035F8782579CD876C08

Page visits: 1381

Time of last update: 2022-12-01 22:22:42

Author of last update: Melvin.boenninger