yycE

yycE
168

unknown

locus
BSU_40430
Molecular weight
15.45 kDa
pI
5.37
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yycE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,156,931 → 4,157,350
The protein
[wiki|Domains]
[wiki|VOC domain] (aa 9-133) (according to UniProt)
Structure
[PDB|1TWU]
[AF|P37479]
Expression and Regulation
Operons
genes
[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]-[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
description
[Pubmed|22383849]
Open in new tab

[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]→[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]

2022-04-29 17:10:09

Jstuelk

18

4a912c55b3406aa5ba6f1c5c8e433c424892e12d

AFBAF653829816EA925A4E727CC7A8D893DA8987

Biological materials
Mutant
MGNA-B829 (yycE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1828 NBRP B. subtilis, Japan]
BKE40430 (Δ[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTACCATCTCCTT,  downstream forward: _UP4_TGATTCTTTCTTATGCTAAA
BKK40430 (Δ[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTACCATCTCCTT,  downstream forward: _UP4_TGATTCTTTCTTATGCTAAA

CA7C472698CB9B9D75573377F42CCEE055D73EDD

Page visits: 975

Time of last update: 2022-10-03 03:30:09

Author of last update: Melvin.boenninger