lonB

lonB
168

Lon-like ATP-dependent protease

locus
BSU_28210
Molecular weight
60.26 kDa
pI
6.27
Protein length
Gene length
function
protein quality control
product
Lon-like ATP-dependent protease
essential
no
synonyms
lonB, ysxF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1067

This gene is a member of the following regulons

Gene
Coordinates
2,882,971 → 2,884,629
The protein
Catalyzed reaction/ biological activity
Hydrolysis of proteins in presence of ATP (according to UniProt)
Protein family
Peptidase S16 family (with [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP] and [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA], according to UniProt)
[wiki|Domains]
Lon proteolytic (aa 349-535) (according to UniProt)
Structure
[PDB|6U5Z] (from E. coli, corresponds to aa 93 ... 538, 27% identity)
[AF|P42425]
[wiki|Localization]
localized to the forespore membrane early in development, followed by localization throughout the forespore later in development [Pubmed|18689473]
Expression and Regulation
Operons
genes
[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]
description
[Pubmed|9852015]
regulation
expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,11325926]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325,11325926], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]

2022-12-29 17:47:35

ghost

33

25b5cbe01d1ae3654f67bdd486e2c4bd14992df4

DE95D5BBCEDF532BA90545C80F13758A97E31AC7

Biological materials
Mutant
BKE28210 (Δ[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGGTCCCTCCTGAAA,  downstream forward: _UP4_TAAACCCTATTTTGATAATA
BKK28210 (Δ[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGGTCCCTCCTGAAA,  downstream forward: _UP4_TAAACCCTATTTTGATAATA
References
Reviews
23479438,34410368
Original Publications
16497325,11325926,9852015,18689473,34757797,36232729

CA90AAE5320C20F93F5ED0F167294C28495756FF

Page visits: 1836

Time of last update: 2023-02-01 07:08:52

Author of last update: Jstuelk