clpP

clpP
168

ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein)

locus
BSU_34540
Molecular weight
21.00 kDa
pI
5
Protein length
Gene length
function
protein degradation
product
ATP-dependent Clp protease proteolytic subunit
essential
no
ec
3.4.21.92
synonyms
clpP, yvdN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0740

This gene is a member of the following regulons

Gene
Coordinates
3,546,234 3,546,827
Phenotypes of a mutant
increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]
non-motile [Pubmed|27014237]
The protein
Catalyzed reaction/ biological activity
Hydrolysis of proteins to small peptides in the presence of ATP and magnesium. Alpha-casein is the usual test substrate. In the absence of ATP, only oligopeptides shorter than five residues are hydrolyzed (such as succinyl-Leu-Tyr-|-NHMec, and Leu-Tyr-Leu-|-Tyr-Trp, in which cleavage of the -Tyr-|-Leu- and -Tyr-|-Trp bonds also occurs) (according to UniProt)
antibiotic-activated [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] unfolds [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] for N-terminal degradation [pubmed|32605984]
Protein family
Peptidase S14 family (with [protein|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA], according to UniProt)
Structure
[PDB|3KTG] [Pubmed|20305655]
[AF|P80244]
Modification
phosphorylated on Arg-13 [Pubmed|22517742]
Effectors of protein activity
the novel antibiotic ADEP (acyldepsipeptides) dysregulates [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] activity and allows [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] degradation in the absence of an ATPase subunit ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC], [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE], or [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]) [Pubmed|21969594]
[wiki|Localization]
cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX], [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] and [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE] [Pubmed|18786145,18689473]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]
description
[Pubmed|9643546]
regulation
induced by heat ([protein|search|CtsR]) [Pubmed|9987115]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [Pubmed|9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9643546], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|9643546,11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]

2023-02-02 17:49:36

ghost

50

d917ea80edea7683547c2442387f8f07a0225547

659F49C1D872F5E008FFCC14D5683C7189CFB002

Biological materials
Mutant
''clpP::spec'' and ''clpP::cat'', available in the [wiki|Leendert Hamoen] lab
BP99 (''clpP''::''tet''), available in [wiki|Fabian Commichau]'s lab [Pubmed|25610436]
GP551 (spc), available in [wiki|Jrg Stlke]'s lab
QB4916 (spc), available in [wiki|Ulf Gerths]'s and [wiki|Jrg Stlke]'s labs
1S139 (''clpP''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S139&Search=1S139 BGSC]
1S140 ( ''clpP''::''spec''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S140&Search=1S140 BGSC]
BKE34540 (''[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]''::''erm'', available in the BGSC and in [wiki|Jrg Stlke]'s lab) [pubmed|28189581]
GP1822 and GP1786 (''[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]''::''erm'', available in [wiki|Jrg Stlke]'s lab)
GPUG1 (erm), available in [wiki|Ulf Gerth]'s and [wiki|Jrg Stlke]'s labs
BKE34540 ([gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
BKK34540 ([gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
Antibody
available in [wiki|Ulf Gerth]'s and [wiki|Jrg Stlke]'s labs
GFP fusion
C-terminal GFP fusions (both single copy and as 2th copy in ''amyE'' locus, also as CFP and YFP variants) available in the [wiki|Leendert Hamoen] lab
labs
[wiki|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]
References
Reviews
16211032,17302811,23375660,23479438,19609260,19781636,26639779,28748186,34410368,34438398
Original Publications
9643546,10809708,11807061,9987115,14679237,18689476,15317791,17586624,11684022,12923101,17560370,16899079,19226326,20070525,9987115,11544224,14763982,9643546,19767395,11112444,9535081,18689473,20305655,20852588,16200071,21969594,22080375,22517742,17380125,12598648,9890793,20049702,20049702,23927726,24263382,24226776,24417481,15378759,23361916,24942655,25212124,25433860,25610436,26387458,27014237,27669037,28760849,29186773,29625553,28333276,31362989,32181548,32442436,32477307,32605984,34181483,34293284,35008890,35593068

CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A

Page visits: 6128

Time of last update: 2023-02-06 07:24:09

Author of last update: Jstuelk