

involved in polyketide synthesis

Molecular weight
85.61 kDa
Protein length
Gene length
polyketide synthesis

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2070

This gene is a member of the following regulons

1,786,104 → 1,788,407
The protein
Catalyzed reaction/ biological activity
holo-[ACP] + malonyl-CoA --> CoA + malonyl-[ACP] (according to UniProt)
Protein family
fabD family (with [protein|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC] and [protein|BB8542A6444564B21FF5DB6E2C75192C6DA2DFB8|fabD], according to UniProt)
[PDB|5DZ7] (N-terminal domain, aa 1 ... 288)
[PDB|4CW5] (C-terminal domain, from B. amyloliquefaciens, corresponds to aa 315 ... 753, 59% identity) [pubmed|25456814]
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-11-28 20:51:32





Open in new tab


2022-11-25 15:41:08





Biological materials
BKE17120 (Δ[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCCCTGGAAAGACATATG,  downstream forward: _UP4_TGAATATTATGAAAATATAC
BKK17120 (Δ[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCCCTGGAAAGACATATG,  downstream forward: _UP4_TGAATATTATGAAAATATAC


Page visits: 2260

Time of last update: 2022-12-02 16:00:41

Author of last update: Melvin.boenninger