rasP

rasP
168

intramembrane protease, cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|ftsL], [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV], [protein|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI] and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW] as well as signal peptides after release of the secreted proteins

locus
BSU_16560
Molecular weight
46.58 kDa
pI
5.14
Protein length
Gene length
function
control of [wiki|cell division], and [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV] and [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW] activity
product
intramembrane protease
essential
no
synonyms
rasP, yluC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0750

This gene is a member of the following regulons

Gene
Coordinates
1,724,029 → 1,725,297
Phenotypes of a mutant
defects in competence development, [wiki|protein secretion] and membrane protein production [Pubmed|23155385]
mutants grow slower in liquid, are not competent, can’t activate [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW], have [wiki|cell division] defects, and decreased long term survival [Pubmed|23687273]
inactivation of [gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP] reduces sporulation efficiency to 1.4% that of wild type cells; delayed entry into sporulation; thin, oblong forespores [Pubmed|26735940]
reduced [wiki|protein secretion] [pubmed|32111210]
a [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP] mutant is not viable, due to lack of expression of [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] [Pubmed|36265902]
The protein
Catalyzed reaction/ biological activity
cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|ftsL], [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV] and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]
cleaves signal peptides after release  of the secreted proteins [Pubmed|21810987]
Protein family
[wiki|peptidase M50B family] (according to UniProt)
[wiki|Domains]
4 transmembrane helices (aa 6 - 26, 175 - 195, 346 - 366, 394 - 414) (according to UniProt)
[wiki|PDZ domain] (aa 190 - 268) (according to UniProt)
Structure
[AF|O31754]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
description
[Pubmed|22383849]
Open in new tab

[gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]→[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]

2023-02-04 13:13:09

Jstuelk

58

babdb9046d2f2d5bae4dac8092e2f7235f01c3e9

23B0B9EE13D6BD9F4D99911E7AA88933F4080154

genes
[gene|4A637EB9B400D30E5C6246D1E0EB5E6A30F38A16|uppS]-[gene|7E7F6BBA03C443A5AFA05A6D9352FEF1212A5AF6|cdsA]-[gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
description
[Pubmed|22383849]
Open in new tab

[gene|4A637EB9B400D30E5C6246D1E0EB5E6A30F38A16|uppS]→[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]

2023-02-03 18:59:07

Jstuelk

57

c6a20b58d42a343484ae9ff8f9312018bf0f82f2

3AF78B34597AE93B1AF63769A0A2561D91069003

additional information
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Biological materials
Mutant
BKE16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC,  downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
BKK16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC,  downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
References
Reviews
29343670,34410368
Original Publications
16899079,15130127,18599827,17020588,19889088,18763711,20644139,21810987,23687273,23155385,26735940,28376795,28674070,32111210,33782055,36265902,36265902

CB50289535EA537F63BADD459BD11AA7759A6658

Page visits: 3304

Time of last update: 2023-02-06 14:09:12

Author of last update: Jstuelk