bofA

bofA
168

inhibition of the pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] processing machinery

locus
BSU_00230
Molecular weight
8.87 kDa
pI
9.32
Protein length
Gene length
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] activation
product
inhibitor of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] processing
essential
no
synonyms
bofA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5848

This gene is a member of the following regulons

Gene
Coordinates
29,772 → 30,035
The protein
Structure
[AF|P24282]
[wiki|Localization]
integral mother cell membrane protein [Pubmed|30403663,11959848]
Expression and Regulation
Operons
genes
[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
description
[Pubmed|22383849]
Open in new tab

[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]→[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]

2022-11-29 00:39:03

Jstuelk

52

1a32cdecddaee24171f48459041fdcb062bafc36

7EC4B7D4D9D0E5E8848420FD5562059E4207233C

genes
[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
description
[Pubmed|1315731]
regulation
expressed during sporulation [Pubmed|1315731]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|1315731], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|1315731], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]

2022-11-22 14:42:05

ghost

42

4ce04fe248906849f3450ff68a7a359545582567

D485E5DC1B8A268A9C122877D751F8CE7CF9CC0D

Biological materials
Mutant
MGNA-A081 (bofA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/81 NBRP B. subtilis, Japan]
1S100 ( ''bofA''::''cat''), [Pubmed|1577688], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S100&Search=1S100 BGSC]
1S96 ( ''bofA''::''erm''), [Pubmed|1315731], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S96&Search=1S96 BGSC]
BKE00230 (Δ[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCATCTCCT,  downstream forward: _UP4_TAATTGATATTATGTATTGA
BKK00230 (Δ[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCATCTCCT,  downstream forward: _UP4_TAATTGATATTATGTATTGA
labs
Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
References
Reviews
31350897,33538382,35638784
Original Publications
11959848,9501233,1577688,15292188,2115401,12940997,12884008,15292188,1315731,15752199,16818230,15087499,30403663,35471152

CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01

Page visits: 3143

Time of last update: 2022-11-29 00:34:54

Author of last update: Jstuelk