opuCC

opuCC
168

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter] (binding protein)

locus
BSU_33810
Molecular weight
33.80 kDa
pI
5.69
Protein length
Gene length
function
compatible solute transport
product
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter] (binding protein)
essential
no
synonyms
opuCC, yvbC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1732

This gene is a member of the following regulons

Gene
Coordinates
3,468,253 → 3,469,164
The protein
Catalyzed reaction/ biological activity
uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
Protein family
OsmX family (with [protein|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC], according to UniProt)
Structure
[PDB|3PPN]  [Pubmed|21366542]
[AF|O32243]
Paralogous protein(s)
[protein|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]
[wiki|Localization]
associated to the membrane (via [protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[protein|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]) [Pubmed|10092453]
lipoprotein [Pubmed|10216873]
Expression and Regulation
Operons
genes
[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]
description
[Pubmed|10216873]
regulation
induced by salt stress [Pubmed|23960087,10216873]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|protein:9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
Open in new tab

[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]→[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]

2022-08-30 17:46:08

Jstuelk

22

b9927d3ec864bbf0176dc1d26fc265e785d98904

9D14B27F8C4184140FD87446DE1DB30E21C27343

Biological materials
Mutant
BKE33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA,  downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
BKK33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA,  downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
References
Reviews
27935846
Original Publications
10092453,9925583,10216873,21296969,21366542,23960087,23646920,28256787,29159878

CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08

Page visits: 1273

Time of last update: 2022-09-29 19:48:27

Author of last update: Melvin.boenninger